Molecular sequence calculator

GC Content Calculator for DNA and RNA

Paste a DNA or RNA sequence to calculate GC percentage, base composition, AT or AU content, GC skew, and reverse complement for primers, oligos, amplicons, and classroom sequence analysis.

Working sequence calculator

Calculate GC content

Paste a DNA or RNA sequence to calculate GC percentage, base counts, AT or AU content, GC skew, and a reverse complement for quick sequence review.

DNA mode accepts A, C, G, T. RNA mode accepts A, C, G, U.

FASTA headers, spaces, line breaks, and numbers are ignored. Ambiguous letters are counted separately and excluded from GC percentage.

GC content

51.72%Moderate GC
This GC percentage is within a common screening range for many short oligos.
Valid length29 nt
GC count15
AT content48.28%
GC skew0.2

Base composition

A7 bases · 24.14%
C6 bases · 20.69%
G9 bases · 31.03%
T7 bases · 24.14%

Reverse complement

CGTTAAGCCTCGTACGCTAACGTACGCAT

Interpretation

  • The GC percentage is in a common screening range for many routine oligo checks.

Educational estimate only. Verify critical lab calculations independently before ordering oligos or preparing real experiments.

GC Content Calculator dashboard showing DNA base composition, GC percentage, and sequence analysis results

GC Content Calculator meaning

A GC Content Calculator measures how much of a DNA or RNA sequence is made of guanine and cytosine. The result is shown as a percentage of valid nucleotide bases. Students use this value to understand base composition. Lab workers use it to review primers, oligos, amplicons, plasmid regions, and short sequence fragments.

GC content matters because G-C base pairs have three hydrogen bonds, while A-T or A-U pairs have two. A sequence with more G and C bases can have a higher melting temperature and stronger local stability. This is why GC percentage is often checked during primer design, PCR planning, qPCR assay review, cloning preparation, and sequence annotation.

How this GC Content Calculator works

Paste a sequence into the input box and choose DNA or RNA. DNA mode accepts A, C, G, and T. RNA mode accepts A, C, G, and U. The calculator removes FASTA headers, line breaks, spaces, and numbers. It counts valid bases and excludes ambiguous symbols from the final percentage.

The formula is simple: GC content equals G plus C divided by total valid bases, multiplied by 100. For example, a 20-base DNA primer with 5 G bases and 5 C bases has 10 GC bases. Its GC content is 10 divided by 20, or 50 percent.

GC Content Calculator results explained

The main result is GC percentage. The tool also shows A, C, G, and T or U counts, AT or AU content, GC skew, and a reverse complement. GC skew compares G and C counts. It can help students see whether one GC base is more common than the other in the entered sequence.

In many quick primer checks, a GC content range around 40 to 60 percent is a common starting point. Low-GC primers may bind weakly. High-GC primers may need adjusted denaturation or annealing conditions. The best range still depends on sequence length, target region, polymerase, salt concentration, and assay design.

Using GC content for primers and oligos

Primer design needs more than one value. GC content helps you judge base balance, but it does not prove that a primer is specific or efficient. After checking GC percentage, review melting temperature, primer length, 3′ end composition, self-complementarity, and expected amplicon size.

For a wider primer review, use the Oligo Analyzer. For a temperature-focused estimate, compare the result with the Primer Tm Calculator. The National Human Genome Research Institute gives a concise definition of GC content as the proportion of bases in DNA or RNA that are guanine or cytosine.NHGRI GC content glossary

Common GC content mistakes to avoid

Do not mix T and U in the same mode. Choose DNA for sequences with T and RNA for sequences with U. Do not include primer names or notes inside the sequence field unless they are FASTA headers starting with the greater-than symbol. Ambiguous letters such as N are useful in some sequence formats, but they do not have a known GC identity, so this tool excludes them from the percentage calculation.

Also check sequence direction. GC percentage is the same in both directions, but reverse complement output depends on strand direction. Most primers and oligos are written 5′ to 3′. If you paste the wrong strand, your interpretation may not match the intended lab design.

When students and lab workers should use it

Students can use this calculator for genetics, molecular biology, biochemistry, and biotechnology assignments. It helps explain base composition, hydrogen bonding, primer stability, melting temperature, and sequence comparison. Teachers can use the output in worksheets, practical demonstrations, and lab report examples.

Lab workers can use it as a quick screening step before ordering an oligo or reviewing a PCR target. For real experiments, verify critical values with your lab protocol, a validated primer design tool, and the oligo supplier’s final order page.

Related tools

Student questions

Student Questions About GC Content Calculator

What does the GC Content Calculator measure?

It measures the percentage of valid bases in a DNA or RNA sequence that are guanine and cytosine. It also reports base counts, AT or AU content, GC skew, and reverse complement.

What formula does this GC calculator use?

GC content is calculated as G plus C divided by the total valid A, C, G, and T or U bases, then multiplied by 100.

Can I paste a FASTA sequence?

Yes. FASTA header lines, spaces, line breaks, and numbers are ignored before the calculation.

What GC content is good for a PCR primer?

Many routine PCR primers are screened around 40 to 60 percent GC content, but the best value depends on the template, primer length, assay design, polymerase, and annealing conditions.

Are ambiguous bases included in the GC percentage?

No. Ambiguous or unsupported letters are counted separately and excluded from the GC percentage because their exact base identity is unknown.